View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_high_41 (Length: 245)
Name: NF0922_high_41
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_high_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 54156391 - 54156226
Alignment:
| Q |
1 |
tattaacttgtttgatttttggttaaagtgatatgtttcttggttcatgtcttctgtgtcttttgcttgcatagtttattttgatatccaaagttttctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54156391 |
tattaacttgtttgatttttggttaaagtgatatgtttcttggttcatgtcttctgtgtcttttgcttgcataatttattttgatatccaaagttttctc |
54156292 |
T |
 |
| Q |
101 |
ttaaccttgaagcggtgttcgactgtggtccatatttttgttttgtattagcttgtttcttctgtg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54156291 |
ttaaccttgaagcggtgttcgactgtggtccatatttttgttttgtattagcttgtttcttctgtg |
54156226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University