View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_1 (Length: 905)
Name: NF0922_low_1
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 1e-86; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 1e-86
Query Start/End: Original strand, 92 - 262
Target Start/End: Original strand, 25772919 - 25773089
Alignment:
| Q |
92 |
ctattgttttgttacatattttgctgattgctactaaattttttggatttcctattaacttattcatgcatagccgtccaatggcctaccgggaatggca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25772919 |
ctattgttttgttacatattttgctgattgctactaaattttttggatttcctattaacttattcatgcatagccgtccaatggcctaccgggaatggca |
25773018 |
T |
|
| Q |
192 |
gttccattgttctatatgaaattcgatggtttgttgggttgtacgcttttaaaatggaaagaattgccaca |
262 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25773019 |
gttccattgttctatatgaaatttgatggtttgttgggttgtacgcttttaaaatggaaagaattgacaca |
25773089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 455 - 501
Target Start/End: Original strand, 25773596 - 25773642
Alignment:
| Q |
455 |
actataatataaattttcatcatattgtaacaaattatacttatttt |
501 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25773596 |
actataatataaattttcatcatattgtaacaaattacacttatttt |
25773642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 621 - 718
Target Start/End: Original strand, 25773989 - 25774096
Alignment:
| Q |
621 |
gttcatgacccattaatgtgtttcattggcaggggcggacccgagtacttcc--aaat--------aggggcagttgccacccattactcatgtaattat |
710 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| | |||| ||| |||| | |||||||||||||||||| ||||||||||| | |
|
|
| T |
25773989 |
gttcatgacccattaatgtgtttcattggcagggacggaccggggtacatccataaataagggcagatgggcagttgccacccatttctcatgtaattgt |
25774088 |
T |
|
| Q |
711 |
atagtacc |
718 |
Q |
| |
|
|||||||| |
|
|
| T |
25774089 |
atagtacc |
25774096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 440 times since January 2019
Visitors: 6696