View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_15 (Length: 441)
Name: NF0922_low_15
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0922_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 33 - 352
Target Start/End: Complemental strand, 34572641 - 34572318
Alignment:
Q |
33 |
tcataggcattgtttgtgatgacaaaa-tttagtttaaaatacactttgattgaaggaatgaattaattgcttttt----cttcttttcaattaaggtat |
127 |
Q |
|
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
34572641 |
tcattggcattgtttgtgatgacaaaaatttagtttaaaatacactttgattgaaggaatgaattaattgctttttttttcttcttttcaattaaggtat |
34572542 |
T |
 |
Q |
128 |
taagttcctattttgtaaatttgaagatgaacttaaacgcttactttaagggctaattaaaatgtctattcacttgatctagatttggtttaagcacttt |
227 |
Q |
|
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34572541 |
taagttcctatttcgtaaatttgaagatgaacttaa-cgcttactttaagggctaattaaaatgtctattcacttgatctagatttggtttaagcacttt |
34572443 |
T |
 |
Q |
228 |
aatcatatgttttgaatttaaagtctatgagcacattgtggttgttgggaccatattgcagccgcagttgtggcacatcagcacatttgttagctatttt |
327 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34572442 |
aatcatatgttttgaatttaaagtctatgagcacattgtggttgttgggaccatattgcagccgcagttgtggcacatcagcacatttgttagctatttt |
34572343 |
T |
 |
Q |
328 |
cggcaatttcaatacaactagaacc |
352 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
34572342 |
cggcaatttcaatacaactagaacc |
34572318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University