View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_21 (Length: 411)
Name: NF0922_low_21
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0922_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 48443461 - 48443226
Alignment:
Q |
1 |
gtattcttccaacatagtgaatggcaactcatttcccaaatcaatcggcccaatgctttctttcatcaataactctgagaatggagcttgaaagcctgcc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48443461 |
gtattcttccaacatagtgaatggcaactcatttcccaaatcaatcggcccaatgctttctttcatcaataactctgagaatggagcttgaaagcctgcc |
48443362 |
T |
 |
Q |
101 |
ttttcaagattaccaccgttctctgggacgaccatcagggaatgatggaacaaggaccttttcattattctgtcttgcgtcttgaactcgtgtaattgtc |
200 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48443361 |
ttttcaagattaccaccgttctctggtacgaccatcagggaatgatggaacaaggaccttttcattattctgtcttgcgtcttgaactcgtgtaattgtc |
48443262 |
T |
 |
Q |
201 |
tttctcttttcaatttccgatgtttctgcctcctcg |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
48443261 |
tttctcttttcaatttccgatgtttctgcctcctcg |
48443226 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 323 - 400
Target Start/End: Complemental strand, 48443124 - 48443047
Alignment:
Q |
323 |
tgaccattcttgttcctcttcaccactttcatcctgtctgctctcaatatcattctctcccatcccatctccatctct |
400 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
48443124 |
tgaccattcttgttcctcttcaccactttcatcctgtctgttctcaatatcattctctcccatcccatctccatctct |
48443047 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University