View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_22 (Length: 410)
Name: NF0922_low_22
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 29 - 402
Target Start/End: Original strand, 41089914 - 41090303
Alignment:
| Q |
29 |
aaaaatagttttctcttttgctaaaaatagcttcctcttggtcacaatcacnnnnnnnnnnn----gaataaatgttaacgatcacatttatgttggcat |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41089914 |
aaaaatagttttctcttttgctaaaaatagcttcctcttggtcacaatcactttttttttttttttgaataaatgttaacgatcacatttatgttggcat |
41090013 |
T |
 |
| Q |
125 |
atgtggtagggtgtttccatttgatcaacgtctaaaaatacttggaaatatgaatgatttataaacaatg------------ctttaaattaatcccttc |
212 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41090014 |
atgtggtagggtgtttctatttgctcaacgtctaaaaatacttcgaaatatgaatgatttataaacaatgcttatgaaaatgctttaaattaatcccttc |
41090113 |
T |
 |
| Q |
213 |
cagatcaatgacaaggatgtggaaggagagataaggccaagaaaccatttttggcatatatattcattgttttgctgacttcttcctagctgcattgaat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41090114 |
cagatcaatgacaaggatgtggaaggagagataaggccaagaaaccatttttggcatatatattcattgttttgctgacttcttcctagctgcattgaat |
41090213 |
T |
 |
| Q |
313 |
tggcagatctatagactacacatgtttttgtttatgaataccagcaacattcatttgggatttcgatcctcggctgccaaactctctgct |
402 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41090214 |
tcgcagatctatagactacacatgtttttgtttatgaatagcagcaacattcatttgggatttcgatcctcggctgccaaactctttgct |
41090303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University