View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_29 (Length: 368)
Name: NF0922_low_29
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0922_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 174 - 358
Target Start/End: Original strand, 33432629 - 33432818
Alignment:
Q |
174 |
atggtactatatatttccttttcattcttttgtgatgagtagttttgcacatattttcataattgtcatgttta-----attactagtactataactatg |
268 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
33432629 |
atggtactatatatttccttttcattcttttgtgatgagtagttttgcacatattttcataattgtcatgtttaatttaattactagtactataactatg |
33432728 |
T |
 |
Q |
269 |
actacaaaaacaatatattcaagtgggttgtaatgtccccatagcaatcaaggtaactatttttctaacccttgatttttctttcctttg |
358 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33432729 |
actacaaaaacaatatattcaagtgggttgtaatgtccccatagcaatcaaggtaactatttttctaacccttgatttttctttcctttg |
33432818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 86 - 116
Target Start/End: Original strand, 33432542 - 33432572
Alignment:
Q |
86 |
ggctttcaaccaaacattatggtaagtgtaa |
116 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
33432542 |
ggctttcaaccaaacattatggtaagtgtaa |
33432572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University