View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_37 (Length: 335)
Name: NF0922_low_37
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0922_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 121 - 327
Target Start/End: Original strand, 39775053 - 39775259
Alignment:
Q |
121 |
tgtttacagtaatatttatcttaaattagaatattgaaattcgggaaactatatgtgaacttatattgatggattaaatggggaacaacatttttattta |
220 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
39775053 |
tgtttacggtaatatttatcttaaattagaatattgatattcgggaaactatgtgtgaacttatattgatggattaaatggggttcaacatttttattta |
39775152 |
T |
 |
Q |
221 |
aaaataaatgccaaatgaagnnnnnnnntgaataaaccatccaaccaaactcaagtcaagatacaagtcaacacctagtcattgaattgttcctccatcc |
320 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39775153 |
aaaataaatgccaaatgaacaaaaaaaatgaataaaccatccaaccaaactcaagtcaagatacaagtcaacacctagtcattgaattgttcctccatcc |
39775252 |
T |
 |
Q |
321 |
tatgcta |
327 |
Q |
|
|
||||||| |
|
|
T |
39775253 |
tatgcta |
39775259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University