View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_40 (Length: 323)
Name: NF0922_low_40
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_low_40 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 111 - 323
Target Start/End: Original strand, 11064845 - 11065057
Alignment:
| Q |
111 |
gtcaatttcagggataaaaaattgatatttttggttacttagtaatcaatatgggtgaaagaaaattcacaaaatgaattataaaccaggcattggatct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11064845 |
gtcaatttcagggataaaaaattgatatttttggttacttagtaatcaatatgggtgaaagaaaattcacaaaatgaattgtaaaccaggcattggatct |
11064944 |
T |
|
| Q |
211 |
caatttaaggttacttaattatcaaacaaagaacataaataagagtacaaatacctgagaagcaagaagaacagcatctttgtgtagataaagagtgaag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11064945 |
caatttaaggttacttaattatcaaacaaagaacataaataagagtacaaatacctgagaagcaagaagaacagcatctttgtgtagataaagagtgaag |
11065044 |
T |
|
| Q |
311 |
tgacttataagac |
323 |
Q |
| |
|
||||||||||||| |
|
|
| T |
11065045 |
tgacttataagac |
11065057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 214 times since January 2019
Visitors: 6713