View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_43 (Length: 314)
Name: NF0922_low_43
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 104 - 232
Target Start/End: Complemental strand, 43369082 - 43368954
Alignment:
| Q |
104 |
tttcatgtgtctgatgatcttacagaggaagagaaattagagcccattataaatgtcactaacgatccaagtatcaggcttttgaaccgattgtatgcca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43369082 |
tttcatgtgtctgatgatcttacagaggaagagaaattagagcccattataaatgtcactaacgatccaagtatcaggcttttgaaccgattgtatgcca |
43368983 |
T |
 |
| Q |
204 |
agaagaaaaaagaattacttgaagggcct |
232 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
43368982 |
agaagaaaaaacaattacttgaagggcct |
43368954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 103 - 223
Target Start/End: Complemental strand, 43364935 - 43364815
Alignment:
| Q |
103 |
atttcatgtgtctgatgatcttacagaggaagagaaattagagcccattataaatgtcactaacgatccaagtatcaggcttttgaaccgattgtatgcc |
202 |
Q |
| |
|
||||| |||| ||||||||||||| |||||||||||||| |||||| | |||| ||||| | || ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
43364935 |
atttcgtgtgcctgatgatcttaccgaggaagagaaattggagcccttgttaaacatcactgatgacccaagcatcaggcttttgaaccgcttgtatgcc |
43364836 |
T |
 |
| Q |
203 |
aagaagaaaaaagaattactt |
223 |
Q |
| |
|
||||||| || |||| ||||| |
|
|
| T |
43364835 |
aagaagagaagagaactactt |
43364815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 103 - 214
Target Start/End: Original strand, 24618134 - 24618245
Alignment:
| Q |
103 |
atttcatgtgtctgatgatcttacagaggaagagaaattagagcccattataaatgtcactaacgatccaagtatcaggcttttgaaccgattgtatgcc |
202 |
Q |
| |
|
||||||| || |||||||||||| |||||||||||||| |||| || |||| | ||| ||||||||||||||||||| ||||| | |||||||| |
|
|
| T |
24618134 |
atttcatttgcctgatgatcttatggaggaagagaaattggagcagatgttaaacataacttgcgatccaagtatcaggcttatgaactgcttgtatgca |
24618233 |
T |
 |
| Q |
203 |
aagaagaaaaaa |
214 |
Q |
| |
|
||||||| |||| |
|
|
| T |
24618234 |
aagaagagaaaa |
24618245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 11367227 - 11367269
Alignment:
| Q |
167 |
gatccaagtatcaggcttttgaaccgattgtatgccaagaaga |
209 |
Q |
| |
|
|||||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
11367227 |
gatccaaggataaggcttttgaaccgcttgtatgccaagaaga |
11367269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University