View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_46 (Length: 299)
Name: NF0922_low_46
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 65 - 242
Target Start/End: Complemental strand, 14189742 - 14189565
Alignment:
| Q |
65 |
ttgcttacttaacattgccatactaaattcagattaaaaatctccgcgggttataattaacgaaaattcactgaaagcaaatttagcaggatttgttttt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14189742 |
ttgcttacttaacattgccatactaaattcagattaaaaatctccgcgggttataattaatgaaaattcactgaaagcaaatttagcaggatttgttttt |
14189643 |
T |
|
| Q |
165 |
gaaagaaaaaattctgagcgtgatcctattgcatctttcagcagatcatctactatattaattttaaagcttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14189642 |
gaaagaaaaaattctgagcgtgatcctattgcatctttcagcagatcatctactatattaattttaaagcttcatctc |
14189565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 20 times since January 2019
Visitors: 6713