View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_47 (Length: 299)
Name: NF0922_low_47
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0922_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 63 - 237
Target Start/End: Original strand, 36808106 - 36808281
Alignment:
Q |
63 |
caataattaataaggatgatattactctgaatctattgatcagnnnnnnntgctactatgaa-tctacaagcaggtcactaatgttgcccaaggaggatt |
161 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
T |
36808106 |
caataattaataaggatgatattactctgaatctattgatcagaaaaaaatgctactatgaaatctacaagcaggtcactaatgttgctcaaggaggatt |
36808205 |
T |
 |
Q |
162 |
tattcttaatagtgaccactaaacaggcctagcattagcaacattgtagttttacactttgctaacacattgagaa |
237 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36808206 |
tattcttaatagtgaccactaaacaggcctagcattagcaacattgtagttttacactttgctaacacattgagaa |
36808281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University