View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_50 (Length: 286)
Name: NF0922_low_50
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0922_low_50 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 57 - 244
Target Start/End: Complemental strand, 8985189 - 8985002
Alignment:
Q |
57 |
catcagcggcactatcagtgtagatgaggctttgcgcgattgaaggagtgacagagttcattaaccaagaatgaacaaggttgttgcagcggatccacgc |
156 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8985189 |
catcagtggcactatcagtgtagatgaggctttgcgcgattgaaggagtgacagagttcattaaccaagaatgaacaaggttgttgcagcggatccacgc |
8985090 |
T |
 |
Q |
157 |
ttcaaaggttggatcgaaggaatctggcatcggagacgaaccatcaatgaatcggagcttatttttcatgataattgctttcttcatc |
244 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8985089 |
ttcaaaggttggatcgaaggaatctggcatcggaggcgaaccatcaatgaatcggagcttatttttcatgataattgctttcttcatc |
8985002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 57 - 244
Target Start/End: Complemental strand, 14716467 - 14716280
Alignment:
Q |
57 |
catcagcggcactatcagtgtagatgaggctttgcgcgattgaaggagtgacagagttcattaaccaagaatgaacaaggttgttgcagcggatccacgc |
156 |
Q |
|
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14716467 |
catcaacggcactatcagtgtagatgaggctttgcgtgattgaaggagtgacagagttcattaaccaagaatgaacaaggttgttgcagcggatccacgc |
14716368 |
T |
 |
Q |
157 |
ttcaaaggttggatcgaaggaatctggcatcggagacgaaccatcaatgaatcggagcttatttttcatgataattgctttcttcatc |
244 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
T |
14716367 |
ttcaaaggttggatcgaaggaatctggcatcggagacgaaccatcaatgaatcagagcttatttctcatgataattgctttcttcatc |
14716280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University