View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_51 (Length: 280)
Name: NF0922_low_51
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_low_51 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 37 - 280
Target Start/End: Complemental strand, 52824619 - 52824376
Alignment:
| Q |
37 |
gaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattgttgnnnnnnnnnnnnnataagatgtg |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52824619 |
gaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattgttgatatatatatataataagatgtg |
52824520 |
T |
 |
| Q |
137 |
acaatgttaattgggagggattgttatctgtggaactgtgaaatcccccaaactgctgctgaaattgacggtgtttgatctgttatccattttttcagaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824519 |
acaatgttaattgggagggattgttatctgtggaactgtgaaatcccccaaactgctgctgaaattgacggtgtttgatctgttatccattttttcagaa |
52824420 |
T |
 |
| Q |
237 |
taatacagtggtgcttgaggaacacagatcctacgcatgctctc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824419 |
taatacagtggtgcttgaggaacacagatcctacgcatgctctc |
52824376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University