View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_52 (Length: 264)
Name: NF0922_low_52
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0922_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 37240614 - 37240377
Alignment:
Q |
1 |
tcaagggatataacaaactcaaactcattcttaattggtaattaaattgggaccccccacccaaagaaaaattaacatttctttttgccttactttttct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37240614 |
tcaagggatataacaaactcaaactcattcttaattggtaattaaattgggaccccccacccaaagaaaaattaacatttctttttgccttactttttct |
37240515 |
T |
 |
Q |
101 |
tagatttgatctttcatgtcatttttat---nnnnnnnnnnnnnnnnntgcattcaaacccaagttttgctacagaataaaataagaaattgtacataga |
197 |
Q |
|
|
|||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37240514 |
tagatttgatctttcatgtcatttttataaataaaaaaaaaaaaaaaatgtattcaaacccaagttttgctacagaataaaataagaaattgtacataga |
37240415 |
T |
 |
Q |
198 |
aacaccaagaaaaatatctcaaaacccccatgttacct |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
37240414 |
aacaccaagaaaaatatctcaaaacccccatgttacct |
37240377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1175 times since January 2019
Visitors: 6711