View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0922_low_55 (Length: 254)

Name: NF0922_low_55
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0922_low_55
NF0922_low_55
[»] chr8 (1 HSPs)
chr8 (144-204)||(8872083-8872143)


Alignment Details
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 144 - 204
Target Start/End: Complemental strand, 8872143 - 8872083
Alignment:
144 gaacacactatttgaaagaggaactatgattattgttgcaagttttatttggtcacaacat 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8872143 gaacacactatttgaaagaggaactatgattattgttgcaagttttatttggtcacaacat 8872083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University