View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_57 (Length: 252)
Name: NF0922_low_57
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 82 - 161
Target Start/End: Complemental strand, 54395135 - 54395056
Alignment:
| Q |
82 |
gagatgaaataaaatgaatgcaatttaatttctgtcaatttatatcgcttaaatctgatactacctgctaagaggtggct |
161 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54395135 |
gagatgaaataaaatgaatgtaatttaatttctgtcaatttatatcgcttaaatctgatactacctgttaagaggtggct |
54395056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 795 times since January 2019
Visitors: 6705