View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0922_low_59 (Length: 251)

Name: NF0922_low_59
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0922_low_59
NF0922_low_59
[»] chr3 (3 HSPs)
chr3 (9-251)||(31603568-31603810)
chr3 (149-220)||(31606101-31606171)
chr3 (16-44)||(31606219-31606247)


Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 251
Target Start/End: Complemental strand, 31603810 - 31603568
Alignment:
9 agcataggtatttctcagttggtttcaaaggtatgctgcatcgcatggtagtcgcaggggactccaaacccctactcacgtctaatatgtatacgatatc 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
31603810 agcataggtatttctcagttggtttcaaaggtatgctgcatcgcatggtagtcgtaggggactccaaacccctactcacgtctaatatgtatacgatatc 31603711  T
109 atgattttttgcaaaggtaaacgaggtttgatatagcttgtgaaccattataggagggcatggcgaatgctctggcaaattgattagctttgataaatca 208  Q
    |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
31603710 atgattttttgcaaaggtaaacgaggtttgatatagcccgtgaaccattataggagggcatggcgaatgctctggcaaattgattagctttgacaaatca 31603611  T
209 aaatcttattctcgaatacactgggaattaactgctggtactc 251  Q
    ||||||||||||||||||||||||||||| |||||||||||||    
31603610 aaatcttattctcgaatacactgggaattcactgctggtactc 31603568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 149 - 220
Target Start/End: Complemental strand, 31606171 - 31606101
Alignment:
149 tgaaccattataggagggcatggcgaatgctctggcaaattgattagctttgataaatcaaaatcttattct 220  Q
    ||||||||| ||||||| ||||| |||||||||||| |||||||||||||||| ||||||||||||||||||    
31606171 tgaaccattttaggagg-catggtgaatgctctggctaattgattagctttgacaaatcaaaatcttattct 31606101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 44
Target Start/End: Complemental strand, 31606247 - 31606219
Alignment:
16 gtatttctcagttggtttcaaaggtatgc 44  Q
    |||||||||||||||||||||||||||||    
31606247 gtatttctcagttggtttcaaaggtatgc 31606219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University