View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_59 (Length: 251)
Name: NF0922_low_59
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_low_59 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 251
Target Start/End: Complemental strand, 31603810 - 31603568
Alignment:
| Q |
9 |
agcataggtatttctcagttggtttcaaaggtatgctgcatcgcatggtagtcgcaggggactccaaacccctactcacgtctaatatgtatacgatatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31603810 |
agcataggtatttctcagttggtttcaaaggtatgctgcatcgcatggtagtcgtaggggactccaaacccctactcacgtctaatatgtatacgatatc |
31603711 |
T |
|
| Q |
109 |
atgattttttgcaaaggtaaacgaggtttgatatagcttgtgaaccattataggagggcatggcgaatgctctggcaaattgattagctttgataaatca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31603710 |
atgattttttgcaaaggtaaacgaggtttgatatagcccgtgaaccattataggagggcatggcgaatgctctggcaaattgattagctttgacaaatca |
31603611 |
T |
|
| Q |
209 |
aaatcttattctcgaatacactgggaattaactgctggtactc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31603610 |
aaatcttattctcgaatacactgggaattcactgctggtactc |
31603568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 149 - 220
Target Start/End: Complemental strand, 31606171 - 31606101
Alignment:
| Q |
149 |
tgaaccattataggagggcatggcgaatgctctggcaaattgattagctttgataaatcaaaatcttattct |
220 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
31606171 |
tgaaccattttaggagg-catggtgaatgctctggctaattgattagctttgacaaatcaaaatcttattct |
31606101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 44
Target Start/End: Complemental strand, 31606247 - 31606219
Alignment:
| Q |
16 |
gtatttctcagttggtttcaaaggtatgc |
44 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31606247 |
gtatttctcagttggtttcaaaggtatgc |
31606219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 785 times since January 2019
Visitors: 6696