View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_61 (Length: 251)
Name: NF0922_low_61
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0922_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 81 - 211
Target Start/End: Complemental strand, 44605406 - 44605277
Alignment:
Q |
81 |
tgagtattcggtccgagggatcaactaatctcaaagactaattccaagcctctactagcaggggtcaaattgaagacataacaaacatattatttatgaa |
180 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
44605406 |
tgagtattcggtccgagggatcaactaatctcaaagactaattccaagcctctactagcaggggtcaaattgaagacataacaaaca---tatttatgaa |
44605310 |
T |
 |
Q |
181 |
ttgatcca--acatgaattgttgatatctaaag |
211 |
Q |
|
|
|||||||| |||| |||||||||||||||||| |
|
|
T |
44605309 |
ttgatccaacacataaattgttgatatctaaag |
44605277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 54
Target Start/End: Complemental strand, 44605465 - 44605433
Alignment:
Q |
22 |
catcatcaatattttagtccatgcaacaaattg |
54 |
Q |
|
|
|||||||||||||||||||||||||||| |||| |
|
|
T |
44605465 |
catcatcaatattttagtccatgcaacacattg |
44605433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4 times since January 2019
Visitors: 6700