View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0922_low_61 (Length: 251)

Name: NF0922_low_61
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0922_low_61
NF0922_low_61
[»] chr3 (2 HSPs)
chr3 (81-211)||(44605277-44605406)
chr3 (22-54)||(44605433-44605465)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 81 - 211
Target Start/End: Complemental strand, 44605406 - 44605277
Alignment:
81 tgagtattcggtccgagggatcaactaatctcaaagactaattccaagcctctactagcaggggtcaaattgaagacataacaaacatattatttatgaa 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||    
44605406 tgagtattcggtccgagggatcaactaatctcaaagactaattccaagcctctactagcaggggtcaaattgaagacataacaaaca---tatttatgaa 44605310  T
181 ttgatcca--acatgaattgttgatatctaaag 211  Q
    ||||||||  |||| ||||||||||||||||||    
44605309 ttgatccaacacataaattgttgatatctaaag 44605277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 54
Target Start/End: Complemental strand, 44605465 - 44605433
Alignment:
22 catcatcaatattttagtccatgcaacaaattg 54  Q
    |||||||||||||||||||||||||||| ||||    
44605465 catcatcaatattttagtccatgcaacacattg 44605433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University