View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0922_low_62 (Length: 245)

Name: NF0922_low_62
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0922_low_62
NF0922_low_62
[»] chr4 (1 HSPs)
chr4 (1-166)||(54156226-54156391)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 54156391 - 54156226
Alignment:
1 tattaacttgtttgatttttggttaaagtgatatgtttcttggttcatgtcttctgtgtcttttgcttgcatagtttattttgatatccaaagttttctc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
54156391 tattaacttgtttgatttttggttaaagtgatatgtttcttggttcatgtcttctgtgtcttttgcttgcataatttattttgatatccaaagttttctc 54156292  T
101 ttaaccttgaagcggtgttcgactgtggtccatatttttgttttgtattagcttgtttcttctgtg 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54156291 ttaaccttgaagcggtgttcgactgtggtccatatttttgttttgtattagcttgtttcttctgtg 54156226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1351 times since January 2019
Visitors: 6712