View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_63 (Length: 229)
Name: NF0922_low_63
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 46214933 - 46215054
Alignment:
| Q |
1 |
tttttgtctaaatggtaaaaataatctgtctaagcttcatgaatttgtatgtgcagggttcattttcttccttaaactcgctagttcgccaatatttgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46214933 |
tttttgtctaaatggtaaaaataatctgtctaagcttcatgaatttgtatgtgcagggttcattttcttccttaaactcgctagttcgccaatatttgtc |
46215032 |
T |
|
| Q |
101 |
tgacaagaagccggaggaaatt |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46215033 |
tgacaagaagccggaggaaatt |
46215054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 768 times since January 2019
Visitors: 6705