View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0922_low_65 (Length: 219)
Name: NF0922_low_65
Description: NF0922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0922_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 35 - 74
Target Start/End: Original strand, 46986321 - 46986360
Alignment:
| Q |
35 |
aatatttgaacaagtaacactctcttccatcattctaatg |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46986321 |
aatatttgaacaagtaacactctcttccatcattctaatg |
46986360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University