View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0924_high_11 (Length: 253)
Name: NF0924_high_11
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0924_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 4 - 166
Target Start/End: Complemental strand, 2625286 - 2625128
Alignment:
Q |
4 |
gttttgtggatattcttcgcgcaatgcaagaagttcccggaaaaggcagattcggtcccctctatccaactgggcgagtcagtttgtaagagtctctgtc |
103 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
T |
2625286 |
gttttgtggatattcttcgcgcaatgcaagaagttcccggaaaaggcagattcggtcccctctatccaactgggtgagtcggtttgtaagagtctctgtc |
2625187 |
T |
 |
Q |
104 |
cgatattcccacnnnnnnnnnnnngttaaaatggagtctccgacctgctcatgaaggacatgc |
166 |
Q |
|
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
T |
2625186 |
cgatattcccac----ttttttttgctaaaatggagtctccgacctgctcatgaaggacatgc |
2625128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 169 - 243
Target Start/End: Complemental strand, 2625038 - 2624964
Alignment:
Q |
169 |
atggtagtgctcatacatggtttggcaaatgtccacctcttatgctcctaatcgtgattttcactataccctatg |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
T |
2625038 |
atggtagtgctcatacatggtttggcaaatgtgcacctcttacgctcctaaccgtgattttcactataccctatg |
2624964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1369 times since January 2019
Visitors: 6712