View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0924_high_7 (Length: 302)
Name: NF0924_high_7
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0924_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 54 - 238
Target Start/End: Complemental strand, 21643977 - 21643793
Alignment:
Q |
54 |
agaagtggtgaaagtgcttttacttcatcaactgaatgtgcataaaagagtgcatcaactttttgagggtacattgctgcccattgtgttatgtagccag |
153 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21643977 |
agaagtggtgaaagtgcttttacttcatcaactgaatgtgcataaaagagtgcatcaactttttgagggtacattgctgcccattgtgttatgtagccag |
21643878 |
T |
 |
Q |
154 |
atgaaagtgctttccaccattgatcatcgcgtacttgaactatgtctttgaaaattactgttgtttcggatacgtaggctagtct |
238 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21643877 |
atgaaagtgctttccaccattgatcatcgcgtacttgaactatgtctttgaaaattactgttgtttcggatacgtaggctagtct |
21643793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University