View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0924_high_9 (Length: 268)
Name: NF0924_high_9
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0924_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 131 - 237
Target Start/End: Original strand, 11820290 - 11820396
Alignment:
Q |
131 |
caagaaccctttaaattaggtgccacaaagccagagaggaagaactannnnnnnactcaagattgaggtttagagtctctctagtttcatctgtttatag |
230 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
11820290 |
caagaaccctttaaattaggagccacaaagccagagaggaagaactattttcttactcaagattgaagtttagagtctctctagtttcatctgtttatag |
11820389 |
T |
 |
Q |
231 |
aattacc |
237 |
Q |
|
|
||||||| |
|
|
T |
11820390 |
aattacc |
11820396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University