View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0924_low_24 (Length: 268)

Name: NF0924_low_24
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0924_low_24
NF0924_low_24
[»] chr8 (1 HSPs)
chr8 (131-237)||(11820290-11820396)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 131 - 237
Target Start/End: Original strand, 11820290 - 11820396
Alignment:
131 caagaaccctttaaattaggtgccacaaagccagagaggaagaactannnnnnnactcaagattgaggtttagagtctctctagtttcatctgtttatag 230  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||       |||||||||||| |||||||||||||||||||||||||||||||||    
11820290 caagaaccctttaaattaggagccacaaagccagagaggaagaactattttcttactcaagattgaagtttagagtctctctagtttcatctgtttatag 11820389  T
231 aattacc 237  Q
    |||||||    
11820390 aattacc 11820396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 338 times since January 2019
Visitors: 6696