View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0924_low_32 (Length: 251)
Name: NF0924_low_32
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0924_low_32 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 19395522 - 19395759
Alignment:
Q |
13 |
aatatcatgattaaaacttaagactaaagtataatctaatcataacatcttctgaaaaaactctccaagttttctctcgatttctcactcttcatggtat |
112 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
19395522 |
aatatcatgattaaaacttaagactaaagtataatctaatcataacatcttatgaaaaaactct---agttttctctcgatttctcactcttcatggtat |
19395618 |
T |
 |
Q |
113 |
tttatcttttggcatgtgcttgggatttgtgacaaaatttctcaagttgtttggacttcaaatctccattttacttggttttcttgcttccaaaatttc- |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19395619 |
tttatcttttggcatgtgcttgggatttgtgacaaaatttctcaagttgtttggacttcaaatctccattttacttggttttcttgcttccaaaatttct |
19395718 |
T |
 |
Q |
212 |
-tgagatgtctttcatcggatcaactcaatggtttatacca |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19395719 |
atgagatgtctttcatcggatcaactcaatggtttatacca |
19395759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 466 times since January 2019
Visitors: 6696