View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0924_low_33 (Length: 251)
Name: NF0924_low_33
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0924_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 24909267 - 24909025
Alignment:
| Q |
1 |
agttggagaatgagacaaaaataaagtacaaagagccattagataaatttgtaagatattgaactgtttgtgctttatgattgttgtcttcattaggttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24909267 |
agttggagaatgagacaaaaataaagtacaaagagccattagataaatttgtaagatattgaattgtttgtgctttatgattgttgtcttcattaggttg |
24909168 |
T |
|
| Q |
101 |
agtatgatctcttacattttggatattcactttgttttacttgaaagatcatttaagaactcaaagcctttgatcttcaatttgattttatcaaaggatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24909167 |
agtatgatctcttacattttggatattcactttgttttacttgaaagatcatttaagaacttaaagcctttgatcttcaatttgattttattaaaggatt |
24909068 |
T |
|
| Q |
201 |
aaagtgtcttgacaatttctttggagtcttccttagaataatc |
243 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
24909067 |
gaagtgtctagacaatttctttggagtcttccttaaaataatc |
24909025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 177 times since January 2019
Visitors: 6695