View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0924_low_37 (Length: 228)
Name: NF0924_low_37
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0924_low_37 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 228
Target Start/End: Complemental strand, 9234766 - 9234541
Alignment:
Q |
5 |
cagtttcttgcttccgtttcaactctaatgatttctggaacctagaccatataaagaacgaatatttaggcagattttgttgagctaaccgattcataac |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9234766 |
cagtttcttgcttccgtttcaactctaatgatttccggaacctcgaccgtataaagaacaaatatttaggcagattttgttgagctaaccgattcataac |
9234667 |
T |
 |
Q |
105 |
caaataaaaacataagatgataaatagttgggacaaagacaagac--agtataaaacaaagtaaatatcatttattcaaatctagagaagaacaggaaca |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
9234666 |
caaataaaaacataagatgataaatagttgggacaaagacaagacagagtatacaacaaagtaaatatcatttattcaaatctagagaaacacaggaaca |
9234567 |
T |
 |
Q |
203 |
caccatgaaaaactcatgtaaccttc |
228 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
9234566 |
caccatgaaaaactcatgtaaccttc |
9234541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University