View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0924_low_38 (Length: 214)
Name: NF0924_low_38
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0924_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 33717672 - 33717547
Alignment:
Q |
1 |
caaattcatatttcaacccacaaatagtaatggatccacacacaatgtaaacaaattataaaatgtaactaacatagactatttcaaagaatttacacat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33717672 |
caaattcatatttcaacccacaaatagtaatggatccacaaa--atgtaaacaaattataaaatgtaactaacatagactatttcaaagaatttacacat |
33717575 |
T |
 |
Q |
101 |
gttttgcacagaatcacaattagttcat |
128 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
33717574 |
gttttgcacagaatcacaattagttcat |
33717547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University