View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0924_low_39 (Length: 213)
Name: NF0924_low_39
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0924_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 36141431 - 36141296
Alignment:
Q |
1 |
tcaaacatattgttccttagactgcaagaagaatgagcataccgccgtaagtattatgactaattaagcatgattt---actaataaccatagaagatcc |
97 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
36141431 |
tcaaacatattgttccttagactgcaagaagaatgagcataccgccgtaagtattatgactaattaagcatgatttactactaataaccatagaagatcc |
36141332 |
T |
 |
Q |
98 |
tttctaaatctaaagttacaagcctaccctatgata |
133 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||| |
|
|
T |
36141331 |
tttctaaatctaaagttacaagcctaccttatgata |
36141296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 507 times since January 2019
Visitors: 6696