View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0924_low_40 (Length: 213)

Name: NF0924_low_40
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0924_low_40
NF0924_low_40
[»] chr1 (1 HSPs)
chr1 (1-120)||(48948639-48948758)


Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 48948758 - 48948639
Alignment:
1 ttcttttttggttcttttccttttcatactgaagatgtcaaaaatcaagagaaaggtgaaaaatatcaaatttgtcatttctgcttatacagaatggttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48948758 ttcttttttggttcttttccttttcatactgaagatgtcaaaaatcaagagaaaggtgaaaaatatcaaatttgtcatttctgcttatacagaatggttt 48948659  T
101 ttcatctcctatgtatatgt 120  Q
    ||||||||||||||||||||    
48948658 ttcatctcctatgtatatgt 48948639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1306 times since January 2019
Visitors: 6712