View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0924_low_5 (Length: 486)
Name: NF0924_low_5
Description: NF0924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0924_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 96 - 354
Target Start/End: Complemental strand, 31439290 - 31439032
Alignment:
| Q |
96 |
gattctccccaacataagagaaaacagttcttattgaagatattgcttgctctgcaatcccaccagcaacaccataagactctatcattttcattgtgac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31439290 |
gattctccccaacataagagaaaacagttcttattgaagatattgcttgctctgcaatcccaccagcaacaccataagactctatcattttcattgtgac |
31439191 |
T |
|
| Q |
196 |
atccaacatgatctttccaaatacaagcgccgggacaatgaacatgatggagagtggtatagatgctaatgccagtctccatgaaagtacaaatgcaaag |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31439190 |
atccaacatgatctttccaaatacaagcgccgggacaatgaacatgatggagagtggtatagctgctaatgccagtctccatgaaagtacaaatgcaaag |
31439091 |
T |
|
| Q |
296 |
atgtggcagaaaaagaatgttgacatgtaagtcaagcagtctggtatctacactcagcc |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31439090 |
atgtggcagaaaaagaatgttgacatgtaagtcaagcagtctggtatctacactcagcc |
31439032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 389 - 486
Target Start/End: Complemental strand, 31438997 - 31438900
Alignment:
| Q |
389 |
aattttacttgatcatattgtgaagttataaaattaattagattccacaatacatgtgaaggttagatttattggttccttccaaacaaatgcgtata |
486 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31438997 |
aattttacttgatcatattgtgaagttataaaattaattagattccacaatacatgtgaaggttagatttattggtttcttccaaacaaatgcgtata |
31438900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 255 times since January 2019
Visitors: 6695