View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_39 (Length: 360)
Name: NF0925_high_39
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_high_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 2567046 - 2566915
Alignment:
Q |
8 |
cgaagaatattcattatataccgtcaaagttaagaaatttcaaacaactagctgcgacctagtggtgtagtgtgacgcttgtaggcgtctggtacccgag |
107 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2567046 |
cgaaaaatattcattatataccgtcaaagttaagaaatttcaaacaattagctgcgacctagtggtgtagtgtgacgcttgtaggcgtctggtacccgag |
2566947 |
T |
 |
Q |
108 |
gtggtgcgcttttctaatgatattagtctctc |
139 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
2566946 |
gtggtgcgcttttctaatgatattagtctctc |
2566915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 198 - 267
Target Start/End: Complemental strand, 2566858 - 2566789
Alignment:
Q |
198 |
aatggggccttcgaattgtctaaaaatgtcctccatttttatcacataggttattttcctagcatcaaac |
267 |
Q |
|
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2566858 |
aatggggccttcgaattgtcgaagaatgtcctccatttttatcacataggttattttcctagcatcaaac |
2566789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University