View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_44 (Length: 340)
Name: NF0925_high_44
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_high_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 74 - 228
Target Start/End: Original strand, 43182929 - 43183083
Alignment:
| Q |
74 |
aaaaggtcgtggtcctcttgggacaattctcattttgcaacaagctaggtcacattgtggaacaatgttattctaagcatggtacaagccaaaaaattcg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43182929 |
aaaaggtcgtggtcctcttgggacaattctcattttgcaacaagctaggtcacattgtggaacaatgttattctaagcatggtacaagccaaaaaattcg |
43183028 |
T |
|
| Q |
174 |
gattatatcaattataataccatttatgatgataatgtaaattccactgctctta |
228 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43183029 |
gattatatcaattataatactatttatgatgataatgtaaattccactgctctta |
43183083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 9452967 - 9453007
Alignment:
| Q |
7 |
tatatttaatgaattcaccgcttcatcataaaagagcaaca |
47 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
9452967 |
tatatttaatgaatttaccgcttcatcttaaaagagcaaca |
9453007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 46424154 - 46424194
Alignment:
| Q |
7 |
tatatttaatgaattcaccgcttcatcataaaagagcaaca |
47 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
46424154 |
tatatttaatgaattcatcgcttcatcttaaaagagcaaca |
46424194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 42 times since January 2019
Visitors: 6713