View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_52 (Length: 322)
Name: NF0925_high_52
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_high_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 20 - 234
Target Start/End: Complemental strand, 1006735 - 1006521
Alignment:
Q |
20 |
cataggttgtggctacaagaattaaagttgtatgaaggtatgagtttggacgtgggtattttaaaaaatatgggtataaggaaaaatagtgtaatatttt |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
1006735 |
cataggttgtggctacaagaattaaagttgtatgaaggtatgggtttggacgcgggtattttaaaaaatatgggtataaggacaaatagtgtaatatttt |
1006636 |
T |
 |
Q |
120 |
atatagatcctaccaattgatatccctatatgatatttcccttttttaatgaacaaaagggggataacctgaagaaacaaaattataaacctctagcaaa |
219 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
T |
1006635 |
atatagatcctaccaattcatatccctatatgatatttccctttttttatgaacaaaagggggataacccgaagaaacgaaattataaacctctagcaaa |
1006536 |
T |
 |
Q |
220 |
tagggtactttaatt |
234 |
Q |
|
|
|||||||||||||| |
|
|
T |
1006535 |
cagggtactttaatt |
1006521 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University