View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_54 (Length: 318)
Name: NF0925_high_54
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_high_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 60 - 306
Target Start/End: Complemental strand, 44678791 - 44678545
Alignment:
Q |
60 |
attggtaatagtatcatattttaaagtggttgtataatagtcatattttaaggtgtaattttagagcggatttctacattacaatagtaaaaagcaatat |
159 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44678791 |
attggtaatagtatcatattttaaagtggttgtataatagtcatattttaaggtgtaattttagagcggatttctacattacaatagtaaaaagcaatat |
44678692 |
T |
 |
Q |
160 |
atgatctagattgttttattttgaggacattgtggtagattgcatgtcttactcaaatttggacagttttacgaaatgtcttgaagagttgtgcatgtcc |
259 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44678691 |
atgatctagattgttttattttgaggacattctggtagattgcatgtcttacttaaatttggacagttttacgaaatgtcttgaagagttgtgcatgtcc |
44678592 |
T |
 |
Q |
260 |
tccattgtgtgtcttactaaaataaaaatattaggaatcaaaagtat |
306 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
44678591 |
tccattgtgtgtcttactaaaataaatatattaggaatcaaaagtat |
44678545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 9452967 - 9453007
Alignment:
Q |
7 |
tatatttaatgaattcaccgcttcatcttaaaagagcaaca |
47 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
9452967 |
tatatttaatgaatttaccgcttcatcttaaaagagcaaca |
9453007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 46424154 - 46424194
Alignment:
Q |
7 |
tatatttaatgaattcaccgcttcatcttaaaagagcaaca |
47 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
46424154 |
tatatttaatgaattcatcgcttcatcttaaaagagcaaca |
46424194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1245 times since January 2019
Visitors: 6711