View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_58 (Length: 309)
Name: NF0925_high_58
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_high_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 28256893 - 28257114
Alignment:
Q |
1 |
ttgatttatcaaaggaaagggaaatattattgtttgaatgatggaattaatttcaacatgctggacaagtgaaaatgactgacaaaccttctttaacagc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28256893 |
ttgatttatcaaaggaaagggaaatattattgtttgaatgatggaattaatttcaacatgctggacaagtgaaaatgactgacaaaccttctttaacagc |
28256992 |
T |
 |
Q |
101 |
ggttgctatcttaatatttaatttgtcataaattcaacaaatttcaaaattttgtagagtattggaggaaatatgttgcatgtgtcagaggaccatatct |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28256993 |
ggttgctatcttaatatttaatttgtcataaattcaacaaatttcaaaattttgtagagtattggaggaaatatgttgcatgtgtcagaggaccatatct |
28257092 |
T |
 |
Q |
201 |
agagcaaatcgagtgatattaa |
222 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
28257093 |
agagcaaatcgagtgatattaa |
28257114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University