View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_63 (Length: 281)
Name: NF0925_high_63
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_high_63 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 20 - 271
Target Start/End: Complemental strand, 42968553 - 42968297
Alignment:
| Q |
20 |
gagggaactttatacaagaaccaagaaatggtaaaaataaatcatacacaagatgctcaatatgactgactgttatgtgcttttttcaacagttggagat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42968553 |
gagggaactttatacaagaaccaagaaatggtaaaaataaatcatacacaagatgctcaatatgactgattgttatgtgcttttttcaacagttggagat |
42968454 |
T |
|
| Q |
120 |
ggttgcatgacagaaaagaacagctttattagcagatatgctcaatcatccatgcttgggttgggtgggtgctccatggattgt-----gacaattcact |
214 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42968453 |
ggttgcatgacaggaaagaacagctttattagcagatatgctcaaccatccatgcttgggttgggtgggtgctccatggattgtgacatgacaattcact |
42968354 |
T |
|
| Q |
215 |
agttccacagtgtatggtattggacataaaactgaatgtctcaaggcctttgtttct |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42968353 |
agttccacagtgtatggtattggacataaaactgaatgtctcaaggcctttgtttct |
42968297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 927 times since January 2019
Visitors: 6707