View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_70 (Length: 274)
Name: NF0925_high_70
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_high_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 71 - 258
Target Start/End: Original strand, 42827180 - 42827374
Alignment:
Q |
71 |
gctttgtcactgctttgtaaagagaatttggaaccatcttcgccttcgaactccattcagaattctttagaaatatttggcggtgaaaagtaataaccta |
170 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42827180 |
gctttgtcgctgctttgtaaagagaatttggaaccatcttcgccttcgaactccattcagaattctttagaaatatttggcggtgaaaagtaataaccta |
42827279 |
T |
 |
Q |
171 |
gcaccgttaattctaaagaaa--atatatatattaatgacttaaatatgtaaatggt-----taagttcgcgcatttttggtttggtgcctgcaa |
258 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||| |
|
|
T |
42827280 |
gcaccgttaattctaaagaaaatatatatatattaatgacttaaatatgtaaacggttcttgtaagttcgcgcatttttggtttggtccctgcaa |
42827374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 9452967 - 9453007
Alignment:
Q |
24 |
tatatttaatgaattcaccgcttcatcttaaaagagcaaca |
64 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
9452967 |
tatatttaatgaatttaccgcttcatcttaaaagagcaaca |
9453007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 46424154 - 46424194
Alignment:
Q |
24 |
tatatttaatgaattcaccgcttcatcttaaaagagcaaca |
64 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
46424154 |
tatatttaatgaattcatcgcttcatcttaaaagagcaaca |
46424194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University