View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_74 (Length: 256)
Name: NF0925_high_74
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_high_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 56 - 244
Target Start/End: Complemental strand, 5242955 - 5242773
Alignment:
| Q |
56 |
tttgttgtttagatgccattgttttttctcaaatttggattggttgattatgctatgtagtgtcactttcttgatcagtaagtactcgaagctatgtggt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5242955 |
tttgttgtttagatgccattgttttttctcaaatttggattggttgattatgctatgtagtgtcactttcttgatcagtaagtactcgaagc--tgtggt |
5242858 |
T |
|
| Q |
156 |
taaaacaaatggttaaggggtttatatagatatgtatcaaaatgtgacaaataaattaaataaataatgttgcatgacatgataatatt |
244 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5242857 |
taaaataaatggttaaggggtttatataga----tatcaaaatgtgacaaataaattaaataaataatgttgcatgacatgataatatt |
5242773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 9452967 - 9453007
Alignment:
| Q |
7 |
tatatttaatgaattcaccgcttcatcttaaaagagcaaca |
47 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9452967 |
tatatttaatgaatttaccgcttcatcttaaaagagcaaca |
9453007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 46424154 - 46424194
Alignment:
| Q |
7 |
tatatttaatgaattcaccgcttcatcttaaaagagcaaca |
47 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46424154 |
tatatttaatgaattcatcgcttcatcttaaaagagcaaca |
46424194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 273 times since January 2019
Visitors: 6702