View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_76 (Length: 253)
Name: NF0925_high_76
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_high_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 120 - 222
Target Start/End: Original strand, 41228038 - 41228140
Alignment:
Q |
120 |
atattaatactgagtttatgacaattcttcaatgcttttaattatgtctgttattcattagtattttcttttatgggttaagctttaataatatttgccg |
219 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41228038 |
atattaatacttagtttatgacaattcttcaatgcttttaattatgtgtgttattcattactattttcttttatgggttaagctttaataatatttgccg |
41228137 |
T |
 |
Q |
220 |
att |
222 |
Q |
|
|
||| |
|
|
T |
41228138 |
att |
41228140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 46
Target Start/End: Original strand, 41227932 - 41227964
Alignment:
Q |
14 |
tgttgccaaggtcctctttcttcctcttcccac |
46 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
41227932 |
tgttgccaaggtcctctttcttcctcttcccac |
41227964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 29 times since January 2019
Visitors: 6700