View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_77 (Length: 252)
Name: NF0925_high_77
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_high_77 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 10 - 159
Target Start/End: Original strand, 35956132 - 35956281
Alignment:
Q |
10 |
aataatattttaaacggttgaacaagaagaaaagaatnnnnnnnngctagagatatactcatttgaaatgaccactgtgaagtttttgttgtctcgaaca |
109 |
Q |
|
|
|||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35956132 |
aatagtattttaaacgtttgaacaagaagaaaaggataaaaaaaagctagagatatactcatttgaaatgaccactgtgaagtttttgttgtctcgaaca |
35956231 |
T |
 |
Q |
110 |
agaacactagagagaaattcgcatggttggtactgaagtcatcaggaaaa |
159 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
35956232 |
agaatgctagagagaaattcgcatggttggtactgaagtcgtcaggaaaa |
35956281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 35956620 - 35956668
Alignment:
Q |
182 |
tcaaactaaaataagcaaaagttcacataaataagtgtttagagaatct |
230 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35956620 |
tcaaactaaaataagcaaaagttcacataaataagtgtttagagaatct |
35956668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University