View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_83 (Length: 243)
Name: NF0925_high_83
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_high_83 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 8 - 151
Target Start/End: Original strand, 35956137 - 35956281
Alignment:
Q |
8 |
tattttaaacggttgaacaagaagaaaagaatnnnnnnn-gctagagatatactcatttgaaatgaccactgtgaagtttttgttgtctcgaacaagaac |
106 |
Q |
|
|
||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35956137 |
tattttaaacgtttgaacaagaagaaaaggataaaaaaaagctagagatatactcatttgaaatgaccactgtgaagtttttgttgtctcgaacaagaat |
35956236 |
T |
 |
Q |
107 |
actagagagaaattcgcatggttggtactgaagtcatcaggaaaa |
151 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
35956237 |
gctagagagaaattcgcatggttggtactgaagtcgtcaggaaaa |
35956281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 174 - 222
Target Start/End: Original strand, 35956620 - 35956668
Alignment:
Q |
174 |
tcaaactaaaataagcaaaagttcacataaataagtgtttagagaatct |
222 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35956620 |
tcaaactaaaataagcaaaagttcacataaataagtgtttagagaatct |
35956668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University