View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_high_86 (Length: 232)
Name: NF0925_high_86
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_high_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 4891381 - 4891224
Alignment:
Q |
1 |
gtttaatttttccataatgactattgatgtgattaaattaagttaccaccttttgtttcccaatttaagagattgatgttccaatttatcatagaacaag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4891381 |
gtttaatttttccataatgactattgatgtgattaaattaagttaccaccttttgtttcacaatttaagagattgatgttccaatttatcatagaacaag |
4891282 |
T |
 |
Q |
101 |
acatgctttcgtatcgtctttatagcacggtttctagtttctggtcaatattcttcga |
158 |
Q |
|
|
|| |||||||||||| ||||||||||||||||||||||||||||||||| | |||||| |
|
|
T |
4891281 |
acttgctttcgtatcctctttatagcacggtttctagtttctggtcaatttacttcga |
4891224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 4916247 - 4916155
Alignment:
Q |
1 |
gtttaatttttccataatgactattgatgtgattaaattaagttaccaccttttgtttcccaatttaagagattgatgttccaatttatcata |
93 |
Q |
|
|
|||||||||||||||||| ||||||||| | ||||||| ||| || ||||||||| || |||||| |||||||| | |||||||||| |||| |
|
|
T |
4916247 |
gtttaatttttccataataactattgatattattaaatcaagctaacaccttttgcttaacaatttcagagattggtattccaatttagcata |
4916155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University