View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0925_low_105 (Length: 268)

Name: NF0925_low_105
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0925_low_105
NF0925_low_105
[»] chr4 (2 HSPs)
chr4 (56-244)||(5242773-5242955)
chr4 (7-47)||(9452967-9453007)
[»] chr1 (1 HSPs)
chr1 (7-47)||(46424154-46424194)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 56 - 244
Target Start/End: Complemental strand, 5242955 - 5242773
Alignment:
56 tttgttgtttagatgccattgttttttctcaaatttggattggttgattatgctatgtagtgtcactttcttgatcagtaagtactcgaagctatgtggt 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||    
5242955 tttgttgtttagatgccattgttttttctcaaatttggattggttgattatgctatgtagtgtcactttcttgatcagtaagtactcgaagc--tgtggt 5242858  T
156 taaaacaaatggttaaggggtttatatagatatgtatcaaaatgtgacaaataaattaaataaataatgttgcatgacatgataatatt 244  Q
    ||||| ||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5242857 taaaataaatggttaaggggtttatataga----tatcaaaatgtgacaaataaattaaataaataatgttgcatgacatgataatatt 5242773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 9452967 - 9453007
Alignment:
7 tatatttaatgaattcaccgcttcatcttaaaagagcaaca 47  Q
    ||||||||||||||| |||||||||||||||||||||||||    
9452967 tatatttaatgaatttaccgcttcatcttaaaagagcaaca 9453007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 47
Target Start/End: Original strand, 46424154 - 46424194
Alignment:
7 tatatttaatgaattcaccgcttcatcttaaaagagcaaca 47  Q
    ||||||||||||||||| |||||||||||||||||||||||    
46424154 tatatttaatgaattcatcgcttcatcttaaaagagcaaca 46424194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 755 times since January 2019
Visitors: 6696