View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0925_low_110 (Length: 253)

Name: NF0925_low_110
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0925_low_110
NF0925_low_110
[»] chr3 (2 HSPs)
chr3 (120-222)||(41228038-41228140)
chr3 (14-46)||(41227932-41227964)


Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 120 - 222
Target Start/End: Original strand, 41228038 - 41228140
Alignment:
120 atattaatactgagtttatgacaattcttcaatgcttttaattatgtctgttattcattagtattttcttttatgggttaagctttaataatatttgccg 219  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||    
41228038 atattaatacttagtttatgacaattcttcaatgcttttaattatgtgtgttattcattactattttcttttatgggttaagctttaataatatttgccg 41228137  T
220 att 222  Q
    |||    
41228138 att 41228140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 46
Target Start/End: Original strand, 41227932 - 41227964
Alignment:
14 tgttgccaaggtcctctttcttcctcttcccac 46  Q
    |||||||||||||||||||||||||||||||||    
41227932 tgttgccaaggtcctctttcttcctcttcccac 41227964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1355 times since January 2019
Visitors: 6712