View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_120 (Length: 241)
Name: NF0925_low_120
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_low_120 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 35956131 - 35956281
Alignment:
Q |
1 |
caataatattttaaacggttgaacaagaagaaaagaatnnnnnnnngctagagatatactcatttgaaatgaccactgtgaagtttttgttgtctcgaac |
100 |
Q |
|
|
||||| ||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35956131 |
caatagtattttaaacgtttgaacaagaagaaaaggataaaaaaaagctagagatatactcatttgaaatgaccactgtgaagtttttgttgtctcgaac |
35956230 |
T |
 |
Q |
101 |
aagaacactagagagaaattcgcatggttggtactgaagtcatcaggaaaa |
151 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
35956231 |
aagaatgctagagagaaattcgcatggttggtactgaagtcgtcaggaaaa |
35956281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 174 - 222
Target Start/End: Original strand, 35956620 - 35956668
Alignment:
Q |
174 |
tcaaactaaaataagcaaaagttcacataaataagtgtttagagaatct |
222 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35956620 |
tcaaactaaaataagcaaaagttcacataaataagtgtttagagaatct |
35956668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University