View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_123 (Length: 234)
Name: NF0925_low_123
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0925_low_123 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 92 - 196
Target Start/End: Complemental strand, 35956281 - 35956177
Alignment:
Q |
92 |
ttttcctgatgacttcagtaccaaccatgcgaatttctctctagtgttcttgttcgagacaacaaaaacttcacagtggtcatttcaaatgagtatatct |
191 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35956281 |
ttttcctgacgacttcagtaccaaccatgcgaatttctctctagcattcttgttcgagacaacaaaaacttcacagtggtcatttcaaatgagtatatct |
35956182 |
T |
 |
Q |
192 |
ctagc |
196 |
Q |
|
|
||||| |
|
|
T |
35956181 |
ctagc |
35956177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 21 - 69
Target Start/End: Complemental strand, 35956668 - 35956620
Alignment:
Q |
21 |
agattctctaaacacttatttatgtgaacttttgcttattttagtttga |
69 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35956668 |
agattctctaaacacttatttatgtgaacttttgcttattttagtttga |
35956620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University