View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_130 (Length: 226)
Name: NF0925_low_130
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_low_130 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 9500729 - 9500605
Alignment:
| Q |
1 |
gccagtgatacatccaaacacagtatttatcaatgtagcaaataggttggagaacagaaaattcaactatggtcttccatacaccctagaacctagtcaa |
100 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500729 |
gccagtgatacttccaaacatagtatttatcattgtagcaaataggttggagaacagaaaattcaactatggtcttccatacaccctagaacctagtcaa |
9500630 |
T |
 |
| Q |
101 |
gtttcactttagctgaagggtggag |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9500629 |
gtttcactttagctgaagggtggag |
9500605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University