View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0925_low_134 (Length: 221)
Name: NF0925_low_134
Description: NF0925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0925_low_134 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 5242987 - 5242773
Alignment:
| Q |
1 |
ttgctttgccttctcctcaagctcttgtcggttttgttgtttagatgccattgttttttctcaaatttggattggttgattatgctatgtagtgtcactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5242987 |
ttgctttgccttctcctcaagctcttgtcggttttgttgtttagatgccattgttttttctcaaatttggattggttgattatgctatgtagtgtcactt |
5242888 |
T |
|
| Q |
101 |
tcttgatcagtaagtactcgaagctatgtggttaaaacaaatggttaaggggtttatatagatatgtatcaaaatgtgacaaataaattaaataaataat |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5242887 |
tcttgatcagtaagtactcgaagc--tgtggttaaaataaatggttaaggggtttatataga----tatcaaaatgtgacaaataaattaaataaataat |
5242794 |
T |
|
| Q |
201 |
gttgcatgacatgataatatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5242793 |
gttgcatgacatgataatatt |
5242773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 51
Target Start/End: Original strand, 2954070 - 2954117
Alignment:
| Q |
4 |
ctttgccttctcctcaagctcttgtcggttttgttgtttagatgccat |
51 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
2954070 |
ctttgccttttcctcaagctcttgtcacttttgttgttgagatgccat |
2954117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 431 times since January 2019
Visitors: 6703